RegulonDB RegulonDB 10.9: Gene Sequence
ssrA gene sequence


Size: 363        A: 96  T: 75  G: 102  C: 90

Fasta

 

>ssrA E. coli K12. Version NC_000913.3 GI:556503834
ggggctgattctggattcgacgggatttgcgaaacccaaggtgcatgccgaggggcggtt
ggcctcgtaaaaagccgcaaaaaatagtcgcaaacgacgaaaactacgctttagcagctt
aataacctgcttagagccctctctccctagcctccgctcttaggacggggatcaagagag
gtcaaacccaaaagagatcgcgtggaagccctgcctggggttgaagcgttaaaacttaat
caggctagtttgttagtggcgtgtccgtccgcagctggcaagcgaatgtaaagactgact
aagcatgtagtaccgaggatgtaggaatttcggacgcgggttcaactcccgccagctcca
cca
              
                            

Download fasta file
RegulonDB