RegulonDB RegulonDB 10.9: Gene Sequence
thrT gene sequence


Size: 76        A: 17  T: 18  G: 23  C: 18

Fasta

 

>thrT E. coli K12. Version NC_000913.3 GI:556503834
gctgatatagctcagttggtagagcgcacccttggtaagggtgaggtcggcagttcgaat
ctgcctatcagcacca
              
                            

Download fasta file
RegulonDB