RegulonDB RegulonDB 10.9: Gene Sequence
thrU gene sequence


Size: 76        A: 19  T: 18  G: 20  C: 19

Fasta

 

>thrU E. coli K12. Version NC_000913.3 GI:556503834
gccgacttagctcagtaggtagagcaactgacttgtaatcagtaggtcaccagttcgatt
ccggtagtcggcacca
              
                            

Download fasta file
RegulonDB