RegulonDB RegulonDB 10.8: Gene Sequence
thrW gene sequence


Size: 76        A: 18  T: 19  G: 21  C: 18

Fasta

 

>thrW E. coli K12. Version NC_000913.3 GI:556503834
gccgatatagctcagttggtagagcagcgcattcgtaatgcgaaggtcgtaggttcgact
cctattatcggcacca
              
                            

Download fasta file
RegulonDB