RegulonDB RegulonDB 10.8: Gene Sequence
tyrU gene sequence


Size: 85        A: 20  T: 15  G: 23  C: 27

Fasta

 

>tyrU E. coli K12. Version NC_000913.3 GI:556503834
ggtggggttcccgagcggccaaagggagcagactgtaaatctgccgtcacagacttcgaa
ggttcgaatccttcccccaccacca
              
                            

Download fasta file
RegulonDB