RegulonDB RegulonDB 10.9: Gene Sequence
tyrV gene sequence


Size: 85        A: 19  T: 16  G: 23  C: 27

Fasta

 

>tyrV E. coli K12. Version NC_000913.3 GI:556503834
ggtggggttcccgagcggccaaagggagcagactgtaaatctgccgtcatcgacttcgaa
ggttcgaatccttcccccaccacca
              
                            

Download fasta file
RegulonDB