RegulonDB RegulonDB 10.9: Gene Sequence
dicF gene sequence


Size: 53        A: 5  T: 19  G: 14  C: 15

Fasta

 

>dicF E. coli K12. Version NC_000913.3 GI:556503834
tttctggtgacgtttggcggtatcagttttactccgtgactgctctgccgccc
              
                            

Download fasta file
RegulonDB