RegulonDB RegulonDB 11.0: Gene Sequence
metW gene sequence


Size: 77        A: 14  T: 12  G: 25  C: 26

Fasta

 

>metW E. coli K12. Version NC_000913.3 GI:556503834
cgcggggtggagcagcctggtagctcgtcgggctcataacccgaaggtcgtcggttcaaa
tccggcccccgcaacca
              
                            

Download fasta file
RegulonDB