RegulonDB RegulonDB 10.9: Gene Sequence
gadA gene sequence


Size: 1401        A: 324  T: 321  G: 379  C: 377

Fasta

 

>gadA E. coli K12. Version NC_000913.3 GI:556503834
atggaccagaagctgttaacggatttccgctcagaactactcgattcacgttttggcgca
aaggccatttctactatcgcggagtcaaaacgatttccgctgcacgaaatgcgcgatgat
gtcgcatttcagattatcaatgatgaattatatcttgatggcaacgctcgtcagaacctg
gccactttctgccagacctgggacgacgaaaacgtccataaattgatggatttgtcgatc
aataaaaactggatcgacaaagaagaatatccgcaatccgcagccatcgacctgcgttgc
gtaaatatggttgccgatctgtggcatgcgcctgcgccgaaaaatggtcaggccgttggc
accaacaccattggttcttccgaggcctgtatgctcggcgggatggcgatgaaatggcgt
tggcgcaagcgtatggaagctgcaggcaaaccaacggataaaccaaacctggtgtgcggt
ccggtacaaatctgctggcataaattcgcccgctactgggatgtggagctgcgtgagatc
cctatgcgccccggtcagttgtttatggacccgaaacgcatgattgaagcctgtgacgaa
aacaccatcggcgtggtgccgactttcggcgtgacctacaccggtaactatgagttccca
caaccgctgcacgatgcgctggataaattccaggccgacaccggtatcgacatcgacatg
cacatcgacgctgccagcggtggcttcctggcaccgttcgtcgccccggatatcgtctgg
gacttccgcctgccgcgtgtgaaatcgatcagtgcttcaggccataaattcggtctggct
ccgctgggctgcggctgggttatctggcgtgacgaagaagcgctgccgcaggaactggtg
ttcaacgttgactacctgggtggtcaaattggtacttttgccatcaacttctcccgcccg
gcgggtcaggtaattgcacagtactatgaattcctgcgcctcggtcgtgaaggctatacc
aaagtacagaacgcctcttaccaggttgccgcttatctggcggatgaaatcgccaaactg
gggccgtatgagttcatctgtacgggtcgcccggacgaaggcatcccggcggtttgcttc
aaactgaaagatggtgaagatccgggatacaccctgtacgacctctctgaacgtctgcgt
ctgcgcggctggcaggttccggccttcactctcggcggtgaagccaccgacatcgtggtg
atgcgcattatgtgtcgtcgcggcttcgaaatggactttgctgaactgttgctggaagac
tacaaagcctccctgaaatatctcagcgatcacccgaaactgcagggtattgcccagcag
aacagctttaaacacacctga
              
                            

Download fasta file
RegulonDB