RegulonDB RegulonDB 10.9: Gene Sequence
frmA gene sequence


Size: 1110        A: 255  T: 259  G: 316  C: 280

Fasta

 

>frmA E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcacgtgctgccgttgcatttgctcccggtaaaccgctggaaatcgttgaaatt
gacgttgcaccaccgaaaaaaggtgaagtgctaattaaagtcacccataccggcgtttgc
cataccgacgcatttaccctctccggcgatgacccggaaggtgtattcccggtggttctc
ggtcacgaaggggccggcgttgtggttgaagtcggtgaaggcgtaaccagcgtcaaacct
ggcgaccatgtgatcccgctttacaccgcggagtgcggcgagtgtgagttctgtcgttct
ggcaaaactaacctctgtgttgcggttcgcgaaacccagggtaaaggcctgatgccagac
ggcaccacccgtttttcttacaacgggcagccgctttatcactacatggggtgctctaca
ttcagtgaatacaccgtagtcgcggaagtgtctctggcaaaaattaatccagaagcaaac
catgaacacgtctgcctgctgggctgtggcgtgaccaccggtattggcgcggtacacaac
acagctaaagtccagccaggtgattctgttgccgtgtttggtcttggcgcgattggtctg
gcagtggttcagggcgcgcgtcaggcgaaagcgggtcggattatcgctatcgataccaac
ccgaagaaattcgatctggcgcgtcgcttcggtgctaccgactgcattaacccgaatgac
tacgacaaaccgataaaagatgtcctgttggatatcaacaaatggggtatcgaccatacc
tttgaatgcatcggtaacgtcaacgtgatgcgtgcggcgctggaaagtgcgcaccgcggc
tggggtcagtcggtgatcatcggggtcgcggttgccggtcaggaaatctccacccgtcca
ttccagttggtcactggtcgcgtatggaaaggttccgcgtttggcggcgtgaaaggtcgt
tcccagttaccgggcatggttgaagatgcgatgaaaggtgatatcgatctggaaccgttt
gtcacgcataccatgagcctggatgaaattaatgacgccttcgacctgatgcatgaaggc
aaatccattcgaaccgtaattcgttactga
              
                            

Download fasta file
RegulonDB