RegulonDB RegulonDB 10.9: Gene Sequence
sraB gene sequence


Size: 169        A: 47  T: 57  G: 34  C: 31

Fasta

 

>sraB E. coli K12. Version NC_000913.3 GI:556503834
taggcatatttttttccatcagatatagcgtattgatgatagccattttaaactatgcgc
ttcgttttgcaggttgatgtttgttatcagcactgaacgaaaataaagcagtaacccgca
atgtgtgcgaattattggcaaaaggcaaccacaggctgcctttttcttt
              
                            

Download fasta file
RegulonDB