RegulonDB RegulonDB 10.9: Gene Sequence
rprA gene sequence


Size: 106        A: 29  T: 36  G: 20  C: 21

Fasta

 

>rprA E. coli K12. Version NC_000913.3 GI:556503834
acggttataaatcaacatattgatttataagcatggaaatcccctgagtgaaacaacgaa
ttgctgtgtgtagtctttgcccatctcccacgatgggcttttttt
              
                            

Download fasta file
RegulonDB