RegulonDB RegulonDB 10.9: Gene Sequence
ryeA gene sequence


Size: 272        A: 79  T: 71  G: 72  C: 50

Fasta

 

>ryeA E. coli K12. Version NC_000913.3 GI:556503834
aaagtcagcgaaggaaatgcttctggcttttaacagataaaaagagaccgaacacgattc
ctgtattcggtccagggaaatggctcttgggagagagccgtgcgctaaaagttggcatta
atgcaggcttagttgccttgccctttaagaatagatgacgacgccaggttttccagtttg
cgtgcaaaatggtcaataaaaagcgtggtggtcatcagctgaaatgttaaaaaccgcccg
ttctggtgaaagaactgaggcggtttttttat
              
                            

Download fasta file
RegulonDB