RegulonDB RegulonDB 10.8: Gene Sequence
micA gene sequence


Size: 72        A: 19  T: 22  G: 15  C: 16

Fasta

 

>micA E. coli K12. Version NC_000913.3 GI:556503834
gaaagacgcgcatttgttatcatcatccctgaattcagagatgaaattttggccactcac
gagtggcctttt
              
                            

Download fasta file
RegulonDB