RegulonDB RegulonDB 10.9: Gene Sequence
omrA gene sequence


Size: 88        A: 14  T: 30  G: 22  C: 22

Fasta

 

>omrA E. coli K12. Version NC_000913.3 GI:556503834
cccagaggtattgattggtgagattattcggtacgctcttcgtaccctgtctcttgcacc
aacctgcgcggatgcgcaggtttttttt
              
                            

Download fasta file
RegulonDB