RegulonDB RegulonDB 10.10: Gene Sequence
csrC gene sequence


Size: 246        A: 80  T: 47  G: 77  C: 42

Fasta

 

>csrC E. coli K12. Version NC_000913.3 GI:556503834
atagagcgaggacgctaacaggaacaatgactcaggatgagggtcaggagcgccaggagg
cgaagacagaggattgtcaggaagacaaacgtccggagacgtaattaaacggaaatggaa
tcaacacggattgttccggctaaaggaaaaacagggtgtgttggcggcctgcaaggattg
taagacccgttaagggttatgagtcaggaaaaaaggcgacagagtaatctgtcgcctttt
ttctt
              
                            

Download fasta file
RegulonDB