RegulonDB RegulonDB 11.0: Gene Sequence
rydB gene sequence


Size: 68        A: 17  T: 15  G: 20  C: 16

Fasta

 

>rydB E. coli K12. Version NC_000913.3 GI:556503834
attattcttatcgccccttcaagagctaagccactgagagtgccggagataagcgccgga
tggggtag
              
                            

Download fasta file
RegulonDB