RegulonDB RegulonDB 10.9: Gene Sequence
cyaR gene sequence


Size: 87        A: 25  T: 25  G: 13  C: 24

Fasta

 

>cyaR E. coli K12. Version NC_000913.3 GI:556503834
gctgaaaaacataacccataaaatgctagctgtaccaggaaccacctccttagcctgtgt
aatctcccttacacgggcttatttttt
              
                            

Download fasta file
RegulonDB