RegulonDB RegulonDB 10.9: Gene Sequence
rybB gene sequence


Size: 79        A: 11  T: 30  G: 17  C: 21

Fasta

 

>rybB E. coli K12. Version NC_000913.3 GI:556503834
gccactgcttttctttgatgtccccattttgtggagcccatcaaccccgccatttcggtt
caaggttgatgggttttttgt
              
                            

Download fasta file
RegulonDB