RegulonDB RegulonDB 10.9: Gene Sequence
rybA gene sequence


Size: 340        A: 82  T: 99  G: 79  C: 80

Fasta

 

>rybA E. coli K12. Version NC_000913.3 GI:556503834
gtgctatatctgtatgtaatgcaatcatccctcaaggatcgacgggattagcaagtcagg
aggtcttatgaatgagttcaagaggtgtatgcgcgtgtttagtcattctccctttaaagt
acggttaatgctgctctctatgttgtgcgatatggtcaacaacaaaccgcagcaagataa
accttccgataaatagcggcgtcgcggtacgccgcttcactcctgctttcatgcaggcat
aacgcgttttggtctgaaaaaccccactttttgtcggatttgcaatccccttcgcaaaag
atttgttcgtcagtagttgacctgaacggcggctcgctct
              
                            

Download fasta file
RegulonDB