RegulonDB RegulonDB 10.9: Gene Sequence
omrB gene sequence


Size: 82        A: 20  T: 23  G: 22  C: 17

Fasta

 

>omrB E. coli K12. Version NC_000913.3 GI:556503834
cccagaggtattgataggtgaagtcaacttcgggttgagcacatgaattacaccagcctg
cgcagatgcgcaggtttttttt
              
                            

Download fasta file
RegulonDB