RegulonDB RegulonDB 10.9: Gene Sequence
yncL gene sequence


Size: 96        A: 20  T: 44  G: 20  C: 12

Fasta

 

>yncL E. coli K12. Version NC_000913.3 GI:556503834
atgaatgtttccagtagaactgtagtactgataaatttctttgctgctgttggtttgttt
actcttatctctatgagatttggctggtttatttga
              
                            

Download fasta file
RegulonDB