RegulonDB RegulonDB 10.9: Gene Sequence
ypfM gene sequence


Size: 60        A: 20  T: 17  G: 16  C: 7

Fasta

 

>ypfM E. coli K12. Version NC_000913.3 GI:556503834
atgattgaacgtgaactggggaactggaaagactttatcgaagttatgcttcgtaagtaa
              
                            

Download fasta file
RegulonDB