RegulonDB RegulonDB 11.1: Gene Sequence
yciY gene sequence


Size: 174        A: 49  T: 37  G: 50  C: 38

Fasta

 

>yciY E. coli K12. Version NC_000913.3 GI:556503834
atgaagcggagtagaacggaagtggggcgctggcgcatgcagcgtcaggctagccgacgt
aaatcgcgttggcttgaggggcaatcgcgccgaaatatgcgtatccacagcatcaggaag
tgcattctaaacaaacagcgtaactcgttattgtttgcgatctacaatatctaa
              
                            

Download fasta file
RegulonDB