RegulonDB RegulonDB 10.9: Gene Sequence
mgtS gene sequence


Size: 96        A: 23  T: 36  G: 23  C: 14

Fasta

 

>mgtS E. coli K12. Version NC_000913.3 GI:556503834
atgctgggtaatatgaatgtttttatggccgtactgggaataattttattttctggtttt
ctggccgcgtatttcagccacaaatgggatgactaa
              
                            

Download fasta file
RegulonDB