RegulonDB RegulonDB 10.9: Gene Sequence
tpke11 gene sequence


Size: 88        A: 25  T: 21  G: 21  C: 21

Fasta

 

>tpke11 E. coli K12. Version NC_000913.3 GI:556503834
tcgccctataaacgggtaattatactgacacgggcgaaggggaatttcctctccgcccgt
gcattcatctaggggcaatttaaaaaag
              
                            

Download fasta file
RegulonDB