RegulonDB RegulonDB 10.9: Gene Sequence
tp2 gene sequence


Size: 161        A: 34  T: 42  G: 39  C: 46

Fasta

 

>tp2 E. coli K12. Version NC_000913.3 GI:556503834
actaattctttcgttgctccagacgacgcagagaacgctcacggcggctctcttcacgac
ttctgtcgagcaaaatttcttcgataaaggccagatggcgatgcgatgcttcgcgcgctt
cttccggcttaccggccataatcgcttcaaatatgcgggtg
              
                            

Download fasta file
RegulonDB