RegulonDB RegulonDB 10.10: Gene Sequence
tff gene sequence


Size: 136        A: 35  T: 32  G: 35  C: 34

Fasta

 

>tff E. coli K12. Version NC_000913.3 GI:556503834
cggacttccgatccatttcgtatacacagactggacggaagcgacaatctcactttgtgt
aacaacacacacgtatcggcacatattccggggtgccctttggggtcggtaatatgggat
acgtggaggcataacc
              
                            

Download fasta file
RegulonDB