RegulonDB RegulonDB 10.10: Gene Sequence
C0299 gene sequence


Size: 79        A: 31  T: 14  G: 18  C: 16

Fasta

 

>C0299 E. coli K12. Version NC_000913.3 GI:556503834
gccacgtgagcacaagataagagaacgaaaaatcagcagcctatgcagcgacaaatattg
atagcctgaatcagtattg
              
                            

Download fasta file
RegulonDB