RegulonDB RegulonDB 10.9: Gene Sequence
mcaS gene sequence


Size: 94        A: 21  T: 25  G: 29  C: 19

Fasta

 

>mcaS E. coli K12. Version NC_000913.3 GI:556503834
accggcgcagaggagacaatgccggatttaagacgcggatgcactgctgtgtgtactgta
gagtctggcggatgtcgacagactctatttttt
              
                            

Download fasta file
RegulonDB