RegulonDB RegulonDB 10.9: Gene Sequence
ynaL gene sequence


Size: 174        A: 40  T: 41  G: 36  C: 57

Fasta

 

>ynaL E. coli K12. Version NC_000913.3 GI:556503834
atgacgacacttatttatttgcaaattcctgtccctgaaccgattcctggcgatcctgtt
ccagtgcccgatccgatccctcgcccgcaacccatgcctgacccaccacccgatgaagaa
ccgattaaattgtcgcatcgtgagcgtagatctgcgaggatacgcgcctgctaa
              
                            

Download fasta file
RegulonDB