RegulonDB RegulonDB 10.8: Gene Sequence
micC gene sequence


Size: 109        A: 26  T: 41  G: 19  C: 23

Fasta

 

>micC E. coli K12. Version NC_000913.3 GI:556503834
gttatatgcctttattgtcacagattttattttctgttgggccattgcattgccactgat
tttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttt
              
                            

Download fasta file
RegulonDB