RegulonDB RegulonDB 10.9: Gene Sequence
isrB gene sequence


Size: 160        A: 53  T: 38  G: 33  C: 36

Fasta

 

>isrB E. coli K12. Version NC_000913.3 GI:556503834
gacaataacacctgtataacaaatggtcggagtgccgcgatgaaactgcgcaaaatcctg
aaaagtatgttcaataactattgcaagacgttcaaagacgtaccgccaggcaatatgttc
cgataacaaaaaacctgctccggcaggtttttttgtgtcc
              
                            

Download fasta file
RegulonDB