RegulonDB RegulonDB 10.10: Gene Sequence
isrC gene sequence


Size: 195        A: 59  T: 53  G: 34  C: 49

Fasta

 

>isrC E. coli K12. Version NC_000913.3 GI:556503834
gatcaatatctattttatcgatcgtttatatcgatcgataagctaataataacctttgtc
agtaacatgcacagatacgtacagaaagacattcagggaacaacagaaccacaattcaga
aactcccacagccggacctccggcactgtaaccctttacctgccggtatccacgtttgtg
ggtaccggctttttt
              
                            

Download fasta file
RegulonDB