RegulonDB RegulonDB 10.9: Gene Sequence
C0614 gene sequence


Size: 87        A: 26  T: 29  G: 19  C: 13

Fasta

 

>C0614 E. coli K12. Version NC_000913.3 GI:556503834
ggccggtgtcgataatacgctaaataaacaataattactctcttttgcttgacaaaaaga
gagttactggtgagtattgttttgctg
              
                            

Download fasta file
RegulonDB