RegulonDB RegulonDB 10.9: Gene Sequence
glmY gene sequence


Size: 184        A: 48  T: 44  G: 40  C: 52

Fasta

 

>glmY E. coli K12. Version NC_000913.3 GI:556503834
agtggctcattcaccgacttatgtcagccccttcgggacgtgctacataaaatacgaatg
acgcacaacaaggtgcctgccgtccaacttctgatatcagcgtagctatatcaaccatcg
ggcgaaacgtcgagttaggcaccgccttattccataacaaagccgggtaattcccggctt
tgtt
              
                            

Download fasta file
RegulonDB