RegulonDB RegulonDB 10.9: Gene Sequence
sroA gene sequence


Size: 93        A: 20  T: 18  G: 29  C: 26

Fasta

 

>sroA E. coli K12. Version NC_000913.3 GI:556503834
gttctcaacggggtgccacgcgtacgcgtgcgctgagaaaatacccgtcgaacctgatcc
ggataacgccggcgaagggatttgaggctcctt
              
                            

Download fasta file
RegulonDB