RegulonDB RegulonDB 10.9: Gene Sequence
chiX gene sequence


Size: 84        A: 28  T: 25  G: 15  C: 16

Fasta

 

>chiX E. coli K12. Version NC_000913.3 GI:556503834
acaccgtcgcttaaagtgacggcataataataaaaaaatgaaattcctctttgacgggcc
aatagcgatattggccattttttt
              
                            

Download fasta file
RegulonDB