RegulonDB RegulonDB 10.9: Gene Sequence
hokC gene sequence


Size: 153        A: 37  T: 35  G: 44  C: 37

Fasta

 

>hokC E. coli K12. Version NC_000913.3 GI:556503834
atgaagcagcataaggcgatgattgtcgccctgatcgtcatctgtatcaccgccgtagtg
gcggcgctggtaacgagaaaagacctctgtgaggttcacatccgaactggccagacggag
gttgctgttttcacggcttacgaatccgagtaa
              
                            

Download fasta file
RegulonDB