RegulonDB RegulonDB 10.9: Gene Sequence
sokC gene sequence


Size: 55        A: 12  T: 17  G: 16  C: 10

Fasta

 

>sokC E. coli K12. Version NC_000913.3 GI:556503834
gttcagcatataggaggcctcgggttgatggtaaaatatcactcggggcttttct
              
                            

Download fasta file
RegulonDB