RegulonDB RegulonDB 10.9: Gene Sequence
hokE gene sequence


Size: 153        A: 35  T: 45  G: 46  C: 27

Fasta

 

>hokE E. coli K12. Version NC_000913.3 GI:556503834
atgctgacgaaatatgcccttgcggcagtcatagtgctgtgtttaacggtgctgggattt
acgcttctggtcggagactcgctgtgtgagtttacggtgaaggaacgtaatattgagttt
aaggctgttctcgcttacgaaccgaagaagtag
              
                            

Download fasta file
RegulonDB