RegulonDB RegulonDB 10.9: Gene Sequence
rdlA gene sequence


Size: 67        A: 8  T: 24  G: 18  C: 17

Fasta

 

>rdlA E. coli K12. Version NC_000913.3 GI:556503834
gttctggttcaagattagcccccgttctgttgtcaggttgtacctctcaacgtgcggggg
ttttctc
              
                            

Download fasta file
RegulonDB