RegulonDB RegulonDB 10.9: Gene Sequence
ldrB gene sequence


Size: 108        A: 21  T: 24  G: 34  C: 29

Fasta

 

>ldrB E. coli K12. Version NC_000913.3 GI:556503834
atgacgctcgcgcagtttgccatgactttctggcacgacctggcggcaccgatcctggcg
ggaattattaccgcagcgattgtcggctggtggcgtaaccggaagtaa
              
                            

Download fasta file
RegulonDB