RegulonDB RegulonDB 10.9: Gene Sequence
rdlB gene sequence


Size: 66        A: 8  T: 25  G: 17  C: 16

Fasta

 

>rdlB E. coli K12. Version NC_000913.3 GI:556503834
gtctggtttcaagattagcccccgttctgttgtcaggttttacctctcaacgtgcggggg
ttttct
              
                            

Download fasta file
RegulonDB