RegulonDB RegulonDB 10.9: Gene Sequence
rdlC gene sequence


Size: 68        A: 8  T: 27  G: 17  C: 16

Fasta

 

>rdlC E. coli K12. Version NC_000913.3 GI:556503834
gtctggtttcaagattagcccccgttttgttgtcaggttttacctctcaacgtgcggggg
ttttctct
              
                            

Download fasta file
RegulonDB