RegulonDB RegulonDB 10.9: Gene Sequence
sokB gene sequence


Size: 56        A: 8  T: 19  G: 17  C: 12

Fasta

 

>sokB E. coli K12. Version NC_000913.3 GI:556503834
gctaggttcattcgttggcctcggttgatagaaatatcggtcggggccttcgtctt
              
                            

Download fasta file
RegulonDB