RegulonDB RegulonDB 10.9: Gene Sequence
torI gene sequence


Size: 201        A: 62  T: 51  G: 44  C: 44

Fasta

 

>torI E. coli K12. Version NC_000913.3 GI:556503834
atgcaacacgaactacagcctgattcactggttgatttgaaattcatcatggctgatact
ggctttggtaaaaccttcatctatgaccggattaagtcaggcgacctgccaaaagccaaa
gttatccacgggcgagcaagatggttatatcgtgaccattgtgaattcaaaaataagctc
ttaagccgcgccaatgggtaa
              
                            

Download fasta file
RegulonDB