RegulonDB RegulonDB 10.9: Gene Sequence
sgrS gene sequence


Size: 227        A: 53  T: 66  G: 60  C: 48

Fasta

 

>sgrS E. coli K12. Version NC_000913.3 GI:556503834
gatgaagcaagggggtgccccatgcgtcagttttatcagcactattttaccgcgacagcg
aagttgtgctggttgcgttggttaagcgtcccacaacgattaaccatgcttgaaggactg
atgcagtgggatgaccgcaattctgaaagttgacttgcctgcatcatgtgtgactgagta
ttggtgtaaaatcacccgccagcagattatacctgctggtttttttt
              
                            

Download fasta file
RegulonDB