RegulonDB RegulonDB 10.9: Gene Sequence
yajL gene sequence


Size: 591        A: 124  T: 133  G: 181  C: 153

Fasta

 

>yajL E. coli K12. Version NC_000913.3 GI:556503834
atgagcgcatcggcactggtttgcctcgcccctggtagtgaagagactgaagccgtcacc
actatcgatctgctggttcgcggcggtatcaaagtcaccactgccagcgtcgccagcgat
ggtaacctggcgattacctgctcgcgcggcgtgaagctgctggcggatgcgccgctggtc
gaagtggctgatggcgaatatgacgtgatcgtgctgcctggtggcattaaaggcgcggag
tgttttcgcgatagcactctgctggttgaaaccgttaaacagttccaccgttccgggcgt
atcgtcgcggctatttgcgccgcgccagccaccgtgctggtgccgcacgatatcttcccg
attggtaatatgaccggcttcccgacgctgaaagacaaaattcccgccgaacaatggctg
gacaagcgcgtcgtctgggatgcacgggtaaaattgctgaccagccaggggccgggtaca
gctatcgactttggtctgaaaattatcgacctgttggttgggcgtgaaaaagcccatgaa
gtggcatcacaactggtgatggcggcagggatttataattattacgagtag
              
                            

Download fasta file
RegulonDB