RegulonDB RegulonDB 10.9: Gene Sequence
flgB gene sequence


Size: 417        A: 111  T: 83  G: 106  C: 117

Fasta

 

>flgB E. coli K12. Version NC_000913.3 GI:556503834
atgctcgataagctcgacgccgccttacgttttcaacaagaggcgctcaatctgcgcgcc
cagcgtcaggaagtgctggcagcaaacatcgccaatgccgatacccctggttatcaggcg
cgcgatatcgattttgccagtgaacttaaaaaagtcatgcaacgtggacgggatgcaacc
agtgtggttgcactgacgatgacctcaacgcaacacattccggcgcaggcgctgacgcct
cctaccgcagaactgcaataccgtattccggaccagccttcgcttgacggtaataccgtc
gatatggatcgcgaacgcacccagtttgccgataacagcctgcaataccagatgagcctt
agcgcgttgagcgggcaaatcaaaggcatgatgaacgttttacagagcggaaattaa
              
                            

Download fasta file
RegulonDB